Review



lentiviruses expressing short hairpin rna (shrna) against ucp2 or ndufs3  (Genechem)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Genechem lentiviruses expressing short hairpin rna (shrna) against ucp2 or ndufs3
    Mitochondrial complex I-derived ROS are required for endogenous H 2 S to facilitate microglial phagocytosis of RBCs and spontaneous hematoma clearance following ICH. ( A and B ) Representative fluorescence images showing that microglial deletion of CBS or SQR abolished the elevation of mitochondrial ROS levels in primary microglia treated with RBC lysate (MitoSOX staining, 3 independent replicates). ( C ) Mitochondrial ROS levels in primary microglia infected with lentivirus coexpressing <t>NDUFS3-shRNA</t> (or NC-shRNA) and green fluorescent protein (eGFP) for 4 days and then treated with RBC lysate and/or RBCs (MitoSOX staining, 3 independent replicates). ( D and E ) Representative fluorescence images and quantification data showing that knockdown of NDUFS3 abolished the reduction in ΔΨ m induced by RBC lysate in primary microglia (TMRM staining, n = 9 from 3 independent experiments). ( F ) Immunoblot analysis of NDUFS3 expression in the striatum injected with a lentivirus expressing NDUFS3-shRNA or NC-shRNA for 14 days (representative images from 3 independent experiments). Ipsil: the striatum ipsilateral to lentiviral injection. Contra: contralateral striatum. ( G and H ) Striatal knockdown of NDUFS3 impaired spontaneous hematoma resolution following ICH, and the impairment was not rescued by the H 2 S donor ADT, as indicated by hemorrhagic volumes at days 5 and 14 following ICH (n = 6). ( I – K ) Striatal knockdown of NDUFS3 delayed functional recovery following ICH, and the delay was not rescued by the H 2 S donor ADT (I: neuroscores; J: forelimb placement test; K: corner test; n = 6). ** P < 0.01, *** P < 0.001, ns: not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
    Lentiviruses Expressing Short Hairpin Rna (Shrna) Against Ucp2 Or Ndufs3, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ndufs3+shrna/lentiviral+short+hairpin+rna++shrna++vector/pmc09420393-126-9-10
    Average 90 stars, based on 1 article reviews
    lentiviruses expressing short hairpin rna (shrna) against ucp2 or ndufs3 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "Endogenous H 2 S targets mitochondria to promote continual phagocytosis of erythrocytes by microglia after intracerebral hemorrhage"

    Article Title: Endogenous H 2 S targets mitochondria to promote continual phagocytosis of erythrocytes by microglia after intracerebral hemorrhage

    Journal: Redox Biology

    doi: 10.1016/j.redox.2022.102442

    Mitochondrial complex I-derived ROS are required for endogenous H 2 S to facilitate microglial phagocytosis of RBCs and spontaneous hematoma clearance following ICH. ( A and B ) Representative fluorescence images showing that microglial deletion of CBS or SQR abolished the elevation of mitochondrial ROS levels in primary microglia treated with RBC lysate (MitoSOX staining, 3 independent replicates). ( C ) Mitochondrial ROS levels in primary microglia infected with lentivirus coexpressing NDUFS3-shRNA (or NC-shRNA) and green fluorescent protein (eGFP) for 4 days and then treated with RBC lysate and/or RBCs (MitoSOX staining, 3 independent replicates). ( D and E ) Representative fluorescence images and quantification data showing that knockdown of NDUFS3 abolished the reduction in ΔΨ m induced by RBC lysate in primary microglia (TMRM staining, n = 9 from 3 independent experiments). ( F ) Immunoblot analysis of NDUFS3 expression in the striatum injected with a lentivirus expressing NDUFS3-shRNA or NC-shRNA for 14 days (representative images from 3 independent experiments). Ipsil: the striatum ipsilateral to lentiviral injection. Contra: contralateral striatum. ( G and H ) Striatal knockdown of NDUFS3 impaired spontaneous hematoma resolution following ICH, and the impairment was not rescued by the H 2 S donor ADT, as indicated by hemorrhagic volumes at days 5 and 14 following ICH (n = 6). ( I – K ) Striatal knockdown of NDUFS3 delayed functional recovery following ICH, and the delay was not rescued by the H 2 S donor ADT (I: neuroscores; J: forelimb placement test; K: corner test; n = 6). ** P < 0.01, *** P < 0.001, ns: not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
    Figure Legend Snippet: Mitochondrial complex I-derived ROS are required for endogenous H 2 S to facilitate microglial phagocytosis of RBCs and spontaneous hematoma clearance following ICH. ( A and B ) Representative fluorescence images showing that microglial deletion of CBS or SQR abolished the elevation of mitochondrial ROS levels in primary microglia treated with RBC lysate (MitoSOX staining, 3 independent replicates). ( C ) Mitochondrial ROS levels in primary microglia infected with lentivirus coexpressing NDUFS3-shRNA (or NC-shRNA) and green fluorescent protein (eGFP) for 4 days and then treated with RBC lysate and/or RBCs (MitoSOX staining, 3 independent replicates). ( D and E ) Representative fluorescence images and quantification data showing that knockdown of NDUFS3 abolished the reduction in ΔΨ m induced by RBC lysate in primary microglia (TMRM staining, n = 9 from 3 independent experiments). ( F ) Immunoblot analysis of NDUFS3 expression in the striatum injected with a lentivirus expressing NDUFS3-shRNA or NC-shRNA for 14 days (representative images from 3 independent experiments). Ipsil: the striatum ipsilateral to lentiviral injection. Contra: contralateral striatum. ( G and H ) Striatal knockdown of NDUFS3 impaired spontaneous hematoma resolution following ICH, and the impairment was not rescued by the H 2 S donor ADT, as indicated by hemorrhagic volumes at days 5 and 14 following ICH (n = 6). ( I – K ) Striatal knockdown of NDUFS3 delayed functional recovery following ICH, and the delay was not rescued by the H 2 S donor ADT (I: neuroscores; J: forelimb placement test; K: corner test; n = 6). ** P < 0.01, *** P < 0.001, ns: not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

    Techniques Used: Derivative Assay, Fluorescence, Staining, Infection, shRNA, Knockdown, Western Blot, Expressing, Injection, Functional Assay

    Related Articles

    Knockdown:

    Article Title: SQR mediates therapeutic effects of H 2 S by targeting mitochondrial electron transport to induce mitochondrial uncoupling
    Article Snippet: .. For knockdown of NDUFS3 in HEK293 cells, NDUFS3 shRNA (5’- TCCATCACCATCTTCCAG TTCAAGAGA ATGAGTCCTTCCACGATACC -3’) was designed based on the reported siRNA sequence and packaged into lentivirus by Genechem (Shanghai, China). ..

    shRNA:

    Article Title: SQR mediates therapeutic effects of H 2 S by targeting mitochondrial electron transport to induce mitochondrial uncoupling
    Article Snippet: .. For knockdown of NDUFS3 in HEK293 cells, NDUFS3 shRNA (5’- TCCATCACCATCTTCCAG TTCAAGAGA ATGAGTCCTTCCACGATACC -3’) was designed based on the reported siRNA sequence and packaged into lentivirus by Genechem (Shanghai, China). ..

    Sequencing:

    Article Title: SQR mediates therapeutic effects of H 2 S by targeting mitochondrial electron transport to induce mitochondrial uncoupling
    Article Snippet: .. For knockdown of NDUFS3 in HEK293 cells, NDUFS3 shRNA (5’- TCCATCACCATCTTCCAG TTCAAGAGA ATGAGTCCTTCCACGATACC -3’) was designed based on the reported siRNA sequence and packaged into lentivirus by Genechem (Shanghai, China). ..



    Similar Products

    lentiviruses expressing short hairpin rna (shrna) against ucp2 or ndufs3  (Genechem)
    90
    Genechem lentiviruses expressing short hairpin rna (shrna) against ucp2 or ndufs3
    Mitochondrial complex I-derived ROS are required for endogenous H 2 S to facilitate microglial phagocytosis of RBCs and spontaneous hematoma clearance following ICH. ( A and B ) Representative fluorescence images showing that microglial deletion of CBS or SQR abolished the elevation of mitochondrial ROS levels in primary microglia treated with RBC lysate (MitoSOX staining, 3 independent replicates). ( C ) Mitochondrial ROS levels in primary microglia infected with lentivirus coexpressing <t>NDUFS3-shRNA</t> (or NC-shRNA) and green fluorescent protein (eGFP) for 4 days and then treated with RBC lysate and/or RBCs (MitoSOX staining, 3 independent replicates). ( D and E ) Representative fluorescence images and quantification data showing that knockdown of NDUFS3 abolished the reduction in ΔΨ m induced by RBC lysate in primary microglia (TMRM staining, n = 9 from 3 independent experiments). ( F ) Immunoblot analysis of NDUFS3 expression in the striatum injected with a lentivirus expressing NDUFS3-shRNA or NC-shRNA for 14 days (representative images from 3 independent experiments). Ipsil: the striatum ipsilateral to lentiviral injection. Contra: contralateral striatum. ( G and H ) Striatal knockdown of NDUFS3 impaired spontaneous hematoma resolution following ICH, and the impairment was not rescued by the H 2 S donor ADT, as indicated by hemorrhagic volumes at days 5 and 14 following ICH (n = 6). ( I – K ) Striatal knockdown of NDUFS3 delayed functional recovery following ICH, and the delay was not rescued by the H 2 S donor ADT (I: neuroscores; J: forelimb placement test; K: corner test; n = 6). ** P < 0.01, *** P < 0.001, ns: not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
    Lentiviruses Expressing Short Hairpin Rna (Shrna) Against Ucp2 Or Ndufs3, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ndufs3+shrna/lentiviral+short+hairpin+rna++shrna++vector/pmc09420393-126-9-10
    Average 90 stars, based on 1 article reviews
    lentiviruses expressing short hairpin rna (shrna) against ucp2 or ndufs3 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    ndufs3 shrna  (Genechem)
    90
    Genechem ndufs3 shrna
    Mitochondrial complex I-derived ROS are required for endogenous H 2 S to facilitate microglial phagocytosis of RBCs and spontaneous hematoma clearance following ICH. ( A and B ) Representative fluorescence images showing that microglial deletion of CBS or SQR abolished the elevation of mitochondrial ROS levels in primary microglia treated with RBC lysate (MitoSOX staining, 3 independent replicates). ( C ) Mitochondrial ROS levels in primary microglia infected with lentivirus coexpressing <t>NDUFS3-shRNA</t> (or NC-shRNA) and green fluorescent protein (eGFP) for 4 days and then treated with RBC lysate and/or RBCs (MitoSOX staining, 3 independent replicates). ( D and E ) Representative fluorescence images and quantification data showing that knockdown of NDUFS3 abolished the reduction in ΔΨ m induced by RBC lysate in primary microglia (TMRM staining, n = 9 from 3 independent experiments). ( F ) Immunoblot analysis of NDUFS3 expression in the striatum injected with a lentivirus expressing NDUFS3-shRNA or NC-shRNA for 14 days (representative images from 3 independent experiments). Ipsil: the striatum ipsilateral to lentiviral injection. Contra: contralateral striatum. ( G and H ) Striatal knockdown of NDUFS3 impaired spontaneous hematoma resolution following ICH, and the impairment was not rescued by the H 2 S donor ADT, as indicated by hemorrhagic volumes at days 5 and 14 following ICH (n = 6). ( I – K ) Striatal knockdown of NDUFS3 delayed functional recovery following ICH, and the delay was not rescued by the H 2 S donor ADT (I: neuroscores; J: forelimb placement test; K: corner test; n = 6). ** P < 0.01, *** P < 0.001, ns: not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
    Ndufs3 Shrna, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ndufs3+shrna/ndufs3+shrna/pmc07449675__aaz5752_SM-52-5-27
    Average 90 stars, based on 1 article reviews
    ndufs3 shrna - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Mitochondrial complex I-derived ROS are required for endogenous H 2 S to facilitate microglial phagocytosis of RBCs and spontaneous hematoma clearance following ICH. ( A and B ) Representative fluorescence images showing that microglial deletion of CBS or SQR abolished the elevation of mitochondrial ROS levels in primary microglia treated with RBC lysate (MitoSOX staining, 3 independent replicates). ( C ) Mitochondrial ROS levels in primary microglia infected with lentivirus coexpressing NDUFS3-shRNA (or NC-shRNA) and green fluorescent protein (eGFP) for 4 days and then treated with RBC lysate and/or RBCs (MitoSOX staining, 3 independent replicates). ( D and E ) Representative fluorescence images and quantification data showing that knockdown of NDUFS3 abolished the reduction in ΔΨ m induced by RBC lysate in primary microglia (TMRM staining, n = 9 from 3 independent experiments). ( F ) Immunoblot analysis of NDUFS3 expression in the striatum injected with a lentivirus expressing NDUFS3-shRNA or NC-shRNA for 14 days (representative images from 3 independent experiments). Ipsil: the striatum ipsilateral to lentiviral injection. Contra: contralateral striatum. ( G and H ) Striatal knockdown of NDUFS3 impaired spontaneous hematoma resolution following ICH, and the impairment was not rescued by the H 2 S donor ADT, as indicated by hemorrhagic volumes at days 5 and 14 following ICH (n = 6). ( I – K ) Striatal knockdown of NDUFS3 delayed functional recovery following ICH, and the delay was not rescued by the H 2 S donor ADT (I: neuroscores; J: forelimb placement test; K: corner test; n = 6). ** P < 0.01, *** P < 0.001, ns: not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

    Journal: Redox Biology

    Article Title: Endogenous H 2 S targets mitochondria to promote continual phagocytosis of erythrocytes by microglia after intracerebral hemorrhage

    doi: 10.1016/j.redox.2022.102442

    Figure Lengend Snippet: Mitochondrial complex I-derived ROS are required for endogenous H 2 S to facilitate microglial phagocytosis of RBCs and spontaneous hematoma clearance following ICH. ( A and B ) Representative fluorescence images showing that microglial deletion of CBS or SQR abolished the elevation of mitochondrial ROS levels in primary microglia treated with RBC lysate (MitoSOX staining, 3 independent replicates). ( C ) Mitochondrial ROS levels in primary microglia infected with lentivirus coexpressing NDUFS3-shRNA (or NC-shRNA) and green fluorescent protein (eGFP) for 4 days and then treated with RBC lysate and/or RBCs (MitoSOX staining, 3 independent replicates). ( D and E ) Representative fluorescence images and quantification data showing that knockdown of NDUFS3 abolished the reduction in ΔΨ m induced by RBC lysate in primary microglia (TMRM staining, n = 9 from 3 independent experiments). ( F ) Immunoblot analysis of NDUFS3 expression in the striatum injected with a lentivirus expressing NDUFS3-shRNA or NC-shRNA for 14 days (representative images from 3 independent experiments). Ipsil: the striatum ipsilateral to lentiviral injection. Contra: contralateral striatum. ( G and H ) Striatal knockdown of NDUFS3 impaired spontaneous hematoma resolution following ICH, and the impairment was not rescued by the H 2 S donor ADT, as indicated by hemorrhagic volumes at days 5 and 14 following ICH (n = 6). ( I – K ) Striatal knockdown of NDUFS3 delayed functional recovery following ICH, and the delay was not rescued by the H 2 S donor ADT (I: neuroscores; J: forelimb placement test; K: corner test; n = 6). ** P < 0.01, *** P < 0.001, ns: not significant. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

    Article Snippet: Lentiviruses expressing short hairpin RNA (shRNA) against UCP2 or NDUFS3 (GeneChem, Shanghai, China) were injected into the two sites of the left striatum at a rate of 0.5 μL/min with a 30-gauge needle (1.5 μL of 1 × 10 8 TU/mL lentivirus per injection site).

    Techniques: Derivative Assay, Fluorescence, Staining, Infection, shRNA, Knockdown, Western Blot, Expressing, Injection, Functional Assay